Splitting Nucleotide Sequences in JS with Regexp

Question

I'm trying to split up a nucleotide sequence into amino acid strings using a regular expression. I have to start a new string at each occurrence of the string "ATG", but I don't want to actually stop the first match at the "ATG". Valid input is any ordering of a string of As, Cs, Gs, and Ts.

For example, given the input string: ATGAACATAGGACATGAGGAGTCA I should get two strings: ATGAACATAGGACATGAGGAGTCA (the whole thing) and ATGAGGAGTCA (the first match of "ATG" onward). A string that contains "ATG" n times should result in n results.

I thought the expression /(?:[ACGT]*)(ATG)[ACGT]*/g would work, but it doesn't. If this can't be done with a regexp it's easy enough to just write out the code for, but I always prefer an elegant solution if one is available.

Answer 1

If you really want to use regular expressions, try this:

var str = "ATGAACATAGGACATGAGGAGTCA",
    re = /ATG.*/g, match, matches=[];
while ((match = re.exec(str)) !== null) {
    matches.push(match);
    re.lastIndex = match.index + 3;
}

But be careful with exec and changing the index. You can easily make it an infinite loop.

Otherwise you could use indexOf to find the indices and substr to get the substrings:

var str = "ATGAACATAGGACATGAGGAGTCA",
    offset=0, match=str, matches=[];
while ((offset = match.indexOf("ATG", offset)) > -1) {
    match = match.substr(offset);
    matches.push(match);
    offset += 3;
}

Answer 2

I think you want is

var subStrings = inputString.split('ATG');

KISS :)

Answer 3

Splitting a string before each occurrence of ATG is simple, just use

result = subject.split(/(?=ATG)/i);

(?=ATG) is a positive lookahead assertion, meaning "Assert that you can match ATG starting at the current position in the string".

This will split GGGATGTTTATGGGGATGCCC into GGG, ATGTTT, ATGGGG and ATGCCC.

So now you have an array of (in this case four) strings. I would now go and take those, discard the first one (this one will never contain nor start with ATG) and then join the strings no. 2 + ... + n, then 3 + ... + n etc. until you have exhausted the list.

Of course, this regex doesn't do any validation as to whether the string only contains ACGT characters as it only matches positions between characters, so that should be done before, i. e. that the input string matches /^[ACGT]*$/i.

Answer 4

Since you want to capture from every "ATG" to the end split isn't right for you. You can, however, use replace, and abuse the callback function:

var matches = [];
seq.replace(/atg/gi, function(m, pos){ matches.push(seq.substr(pos)); });

Answer 5

This isn't with regex, and I don't know if this is what you consider "elegant," but...

var sequence = 'ATGAACATAGGACATGAGGAGTCA';
var matches = [];
do {
    matches.push('ATG' + (sequence = sequence.slice(sequence.indexOf('ATG') + 3)));
} while (sequence.indexOf('ATG') > 0);

I'm not completely sure if this is what you're looking for. For example, with an input string of ATGabcdefghijATGklmnoATGpqrs, this returns ATGabcdefghijATGklmnoATGpqrs, ATGklmnoATGpqrs, and ATGpqrs.