Hi all. I have a file. Sequence 1.1.1 ATGCGCGCGATAAGGCGCTA ATATTATAGCGCGCGCGCGGATATATATATATATATATATT Sequence 1.2.2 ATATGCGCGCGCGCGCGGCG ACCCCGCGCGCGCGCGGCGCGATATATATATATATATATATT Sequence 2.1.1 ATTCGCGCGAGTATAGCGGCG NOW,I would like to remove the last digit from each of the line that starts with '>'. For example, in thi...
(This is a database / R commands question) I wish (for my thesis work), to import tRNA data into R and have it aligned. My questions are: 1) What resources can I use for the data. 2) What commands might help me with the import/alignment. So far, I found two nice repositories that holds such data: tRNAdb at the University of Leipzig ...
Hi all, I have a (somewhat complex) web scraping challenge that I wish to accomplish and would love for some direction (to whatever level you feel like sharing) here goes: I would like to go through all the "species pages" present in this link: http://gtrnadb.ucsc.edu/ So for each of them I will go to: The species page link (for ex...