How to eliminate last digit from each of the top lines

Question

Hi all. I have a file.

>Sequence 1.1.1  ATGCGCGCGATAAGGCGCTA   
ATATTATAGCGCGCGCGCGGATATATATATATATATATATT  
>Sequence 1.2.2  ATATGCGCGCGCGCGCGGCG   
ACCCCGCGCGCGCGCGGCGCGATATATATATATATATATATT                 
>Sequence 2.1.1  ATTCGCGCGAGTATAGCGGCG

NOW,I would like to remove the last digit from each of the line that starts with '>'. For example, in this first line, i would like to remove '.1' (rightmost) and in second instance i would like to remove '.2' and then write the rest of the file to a new file. Thanks,

Answer 1

if line.startswith('>Sequence'):
  line = line[:-2] # trim 2 characters from the end of the string

or if there could be more than one digit after the period:

if line.startswith('>Sequence'):
  dot_pos = line.rfind('.') # find position of rightmost period
  line = line[:dot_pos] # truncate upto but not including the dot

Edit for if the sequence occurs on the same line as >Sequence

If we know that there will always be only 1 digit to remove we can cut out the period and the digit with:

line = line[:13] + line[15:]

This is using a feature of Python called slices. The indexes are zero-based and exclusive for the end of the range so line[0:13] will give us the first 13 characters of line. Except that if we want to start at the beginning the 0 is optional so line[:13] does the same thing. Similarly line[15:] gives us the substring starting at character 15 to the end of the string.

Answer 2

map "".join(line.split('.')[:-1]) to each line of the file.

Answer 3

import fileinput
import re

for line in fileinput.input(inplace=True, backup='.bak'):
  line = line.rstrip()
  if line.startswith('>'):
    line = re.sub(r'\.\d$', '', line)
  print line

many details can be changed depending on details of the processing you want, which you have not clearly communicated, but this is the general idea.

Answer 4

import re
trimmedtext = re.sub(r'(\d+\.\d+)\.\d', '$1', text)

Should do it. Somewhat simpler than searching for start characters (and it won't effect your DNA chains)

Answer 5

Here's a short script. Run it like: script [filename to clean]. Lots of error handling omitted.

It operates using generators, so it should work fine on huge files as well.

import sys
import os

def clean_line(line):
    if line.startswith(">"):
        return line.rstrip()[:-2]
    else:
        return line.rstrip()

def clean(input):
    for line in input:
        yield clean_line(line)

if __name__ == "__main__":
    filename = sys.argv[1]

    print "Cleaning %s; output to %s.." % (filename, filename + ".clean")

    input = None
    output = None
    try:
        input = open(filename, "r")
        output = open(filename + ".clean", "w")
        for line in clean(input):
            output.write(line + os.linesep)
            print ": " + line
    except:
        input.close()
        if output != None:
            output.close()