I am attempting to manage an ajax connection by calling a button onclick method on a separate web part in order to force the partial postback on the consumer. Web part A (Provider) invokes the method on Web Part B (Consumer) Web Part A Type t = myButton.GetType(); object[] p = new object[1]; p[0] = EventArgs....
I want to show a message box when users trying to do any major operations in my web part. If user choince [Yes], then continue to do sometiing ...[No] for nothing. How can i implements this function in my web part , Sharepoint 2007 ?? pls help me ~~ thx ...
Can you embed one SharePoint web part into another? For example, a client wants a document library but also an ability to write an executive summary about that document using the rich text editor tool. Can this be done? ...
Hi all. In the below file I have 3 occurrences of '.1'. I want to eliminate the last one and write the rest of file to a new file. Kindly suggest some way to do it in PYTHON and thank you all. d1dlwa_ a.1.1.1 (A:) Protozoan/bacterial hemoglobin {Ciliate (Paramecium caudatum) [TaxId: 5885]} slfeqlggqaavqavtaqfyaniqadatvatffngidmpnqt...
If you include the default wiki web part on a page it just shows the names of the articles. I'm looking for a way to actually embed the nicely formated wiki data inside a web part. TIA, Robert ...
Hi all. I have a file. >Sequence 1.1.1 ATGCGCGCGATAAGGCGCTA ATATTATAGCGCGCGCGCGGATATATATATATATATATATT >Sequence 1.2.2 ATATGCGCGCGCGCGCGGCG ACCCCGCGCGCGCGCGGCGCGATATATATATATATATATATT >Sequence 2.1.1 ATTCGCGCGAGTATAGCGGCG NOW,I would like to remove the last digit from each of the line that starts with '>'. Fo...
How to remove a blank page that gets added automatically after \part{} or \chapter{} in a book document class? I need to add some short text describing the \part. Adding some text after the part command results in at least 3 pages with an empty page between the part heading and the text: Part xx (empty) some text How to get rid of t...
Hello, sorry for the properly stupid question, but I am quite a newbie. I have loads of files which look like this: DET01-ABC-5_50-001.dat ... DET01-ABC-5_50-0025.dat and I want them to look like this: DET01-XYZ-5_50-001.dat ... DET01-XYZ-5_50-0025.dat how can I do this? I tried several things from this forum but I seem to make a...
In this question I asked, how to produce rules under sections. The answer provided using sectsty does what I wish, but triggers a problem: If I use the package sectsty the \part-command produces an error: ! Undefined control sequence. \NR@part ...elax \refstepcounter {part}\@maybeasf \a...
i have some part of text with html tags , for example <b>something</b> i select some part of text for example "some". with getSelection().getRangeAt(0); i get position of caret (textcursor), so i know which part of text i've selected. i have startOffset and endOffset. but problem is, that startOffset and endOffset ignores html ta...
Need to convert a web part to a field control on a Sharepoint page. Part of the problem is to migrate all the content on existing pages that use the web part to the corresponding field control. Any ideas on how to accomplish this as painlessly as possible? ...
I need to get some part of html pages using php XPath query (sorry im new to XPath). example html page <html><head>blah lines</head><body> <div id="mytable"> <table><tr><td>table cell value</td></tr></table> </div> <body><html> is there any way to get div contents of above example along with html tags using XPath ...
I'm writing a book using LaTeX. I have a bunch of chapters that are going to be sectioned into three main parts of the book. How can I markup this kinda thing with LaTeX? Specifically: I'd like to make a table of contents which looks kinda like PART I Chapter 1 - Some heading - Some heading 2 Chapter 2 - ... Chapter 3 Part...
I want count the same elements of two lists. Lists can have duplicate elements, so I can't convert this to sets and use & operator. a=[2,2,1,1] b=[1,1,3,3] set(a) & set(b) work a & b don't work It is possible to do it withoud set and dictonary? ...
I have created a web part Page and need to add css and javascript code to it. I am using Sharepoint 3. ...
I have a web part which is going to be a part of pair of connected web parts. For simplicity, I am just describing the consumer web part. This web part has 10 link buttons on it. And they are rendered in the Render method instead ofCreateChildControls as this webpart will be receiving values based on input from the provider web part. E...
Is it possible to develop a web-part in ASP.NET (framework > 2.0), to have a sandbox architecture, and deploy those web parts inside Share Point 2010 and/or MOSS 2007 we donot want to use any SharePoint dll reference with web parts we develop. we refer to the url, section at http://msdn.microsoft.com/en-us/library/ee539417.aspx (secti...
Hello, I'm using commons-httpclient-3.1 inside my android application. And I would like to know if it possible to manipulate Part (org.apache.commons.httpclient.methods.multipart.Part) dynamically? Essentially adding new FilePart and new StringPart at runtime before sending the request. Every example I've found until now suppose that y...
By education and initial experience, I am a desktop developer. I am currently working as a SharePoint developer on corporate internal websites. My experience with building ASP.Net applications from scratch is limited. I would like to know how I can build custom webparts on an ASP.Net platform (v3 or v3.5) and allow custom properties to...
Was little bit difficult to formulate the title for my question since is kind of abstract... Let me try to explain. I have a main code which has a git repository, I decided to take part of that code and make it a stand alone app. with its own name and versions to be distributed. Is there a way to keep the main code and that other branc...