How To Create a Quick Minimal Firefox Extension?
What the minimum basic setup required to begin developing a Firefox extension? ...
xul
How do I get the mouse button pressed from a command event in XUL?
It seems that the XUL command and click events are somewhat different. Although my function does get called when using the command event, the event object does not contain the button property. My question is: how do I detect what mouse button that was pressed without using the click event? The simplest code that can demonstrate my pro...
Embedding XULRunner application on Java
Hi, My goal is to get Limewire(JAVA) and Songbird(XULRunner) to run together. I was thinking the best way is to run the XUL application(songbird) inside a JAVA swing panel. Is there another way? Would it be better or possible to have the GUI entirely in XUL, and then access my JAVA objects somehow? How would I go about doing this? T...
Opening a URL in current tab/window from a Firefox Extension
I am creating a Firefox Extension...what would be the javascript to open a URL in the current tab from a menuitem? e.g. in my overlay.xul file i have the following line: <menuitem label="Visit homepage" oncommand="window.location='http://www.somepage.com'"/> but in firefox, when i click on the menu item, it opens the URL but it sc...
popen equivalent in XPCOM?
I'm trying to use XULRunner to add a GUI to a command line based program. One solution would be to use something like popen from the XUL application to interact with the command line program. Does XPCOM have popen? Alternatively, does XPCOM have enough primitives to create popen? Is there another approach that gives access to the standar...
Is there a way to run ActiveX components in Firefox through the use of a plugin?
I have an ActiveX plugin that we need (if possible) to run in Firefox. Is there a plugin (or other way) for Firefox that will allow this? ...
Drawing a user interface based on preferences
I want to use the built-in preference system for my xulrunner (Firefox) application. But I can't figure out how to easily drive the user interface based on preferences. The user can specify a list of home pages, and each home page will show up in a different tab. Because the tabs are in the presentation layer, I'd like to create them ...
Beginning XUL & XPCOM development with XULRunner?
I am planning to design an application XUL & XPCOM for proprietary system. So i have decided to use C/C++ but how can I start the development as a beginner in this field I cannot find a good guide to start around. It will be good if you can give some links and books. I also would like to know how to prevent the user from modifying the co...
How to perform a background load and scraping of a page with XUL/Firefox Extension
I want to scrape the user pages of SO to give the owners of my toolbar the updated information on their questions/answers/etc... This means I need to do this in the background, parse the pages, extract the content, compare it with the last run and then present the results either on the toolbar or the status bar, or alternatively, on a p...
How to make Firefox extension auto install in nav bar?
I'm working on a Firefox extension. I'd like to make it auto-install in the far right position on the nav bar when a user installs it. As it stands, a user has to go to View > Toolbars > Customize... and drag the extension to the nav bar once it's installed. I'd like to eliminate this step. The extension is here: http://madan.org/ticker...
Finding the currently logged in user from a Firefox extension
I'm writing a Firefox extension that needs to know what the username of the currently logged in user is in Windows, Mac, or Linux. So if I'm logged into my machine as "brh", it'll return "brh". Any idea how to do that from extension JavaScript? ...
xul runner
I know this is probably a stupid question, but I am not computer literate. What is an xul runner? The reason I ask is because every email that I get with a link attached I keep getting " Platform Version 1.9.0.4 not compatible with min version>=1.9.0.5 max version <=1.9.0.5. I don't have a clue how to get rid of xul runner or what I ne...
Get current page URL from a firefox sidebar extension
I'm writing a sidebar extension for Firefox and need a way to get the URL of the current page so I can check it against a database and display the results. How can I do this? ...
Forcing a description widget to wrap in XUL
I am trying to get a description in a XUL application to wrap, even if it contains long lines. For example, if I save the following as a .xul file and open it in Firefox, it looks fine and wraps appropriately: <?xml version="1.0"?> <?xml-stylesheet href="chrome://global/skin/" type="text/css"?> <window id="theWindow" title="T...
In firefox, how to change color of text in a treecell using javascript
BACKGROUND: I have the following XUL fragment <tree id="treeToChange" flex="1"> <treecols> <treecol label = "First Column" id="c1" flex="1"/> <treecol label = "Second Column" id="c2" flex="1"/> </treecols> <treechildren> <treeitem> <treerow> <treecell label="Data for Column 1"/> <treecell label="D...
How do I get a usemap working within a firefox XUL document
In my XUL I have the following code fragments: <map name="KeypadMap"> <area href="javascript:pad('A')" coords="1,1,31,31" shape="rect"/> </map> ... <hbox flex="1"> <image src="./keypad.png" width="32" height="32" useMap="#KeypadMap"/> </hbox> The image displays just fine, however, when I mouse over, the cursor does not change to a ha...
dragover mouse event contain file info in XUL application using javascript
I'm writing a XUL application using JavaScript for the coding. I would like to be able to drag files onto a control in this application and, when dropped, have them show up. This seems like it would be almost exactly like the tutorial here, but when I break in the drag and drop event handlers in a debugger, the dataTransfer member of th...
Is anyone using a firefox XUL IDE?
I'm not interested in Firebug, a XUL debugger, or a JavaScript editor, but a true WYSIWYG IDE for XUL form design. ...
CSS: how can I force a long string (without any blank) to be wrapped in XUL and/or HTML
I have a long string (a DNA sequence). It does not contain any whitespace character. e.g.: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA what would be the css selector to force this text to be wrapped in an html:textarea or in a xul:textbox Thanks. ...
How best to deploy my XUL app?
I have a xul app that I think would be useful, and I want to deploy it. The target platform is Linux; I believe it will work on Windows/OSX as well but haven't tested. What is the best way to deploy this app? Is using xpi packages and requiring the user to install xulrunner separately the way to go? If I bundle xulrunner, should I keep...