Is there any way to automatically wrap comments at the 80-column boundary as you type them? ..or failing that, any way to display a faint line at the coulmn 80 boundary to make wrapping them manually a little easier? Several other IDEs I use have one or other of those functions and it makes writing comments that wrap in sensible places ...
Hi all, I was wondering if anyone would be able to help me refactor some code that I wrote a while ago. I wrote a wrapper for a COM object that only excepted strings as input, so in good OOP practice I wrapped the string up in a function so that it was easier to build and call. I was just wondering if anyone could think of a better w...
Hey, I want to have two items on the same line using 'float: left' for the item on the left. I have no problems achieving this alone. The problem is, I want the two items to stay on the same line even when you resize the browser very small. You know... like how it was with tables. The goal is to keep the item on the right from wrapping...
What's your preferred way of wrapping lines of code, especially when it comes to long argument lists? There has been several questions relating to wrapping lines (such as When writing code do you wrap text or not? and Line width formatting standard), but I haven't been able to find one which covers where to wrap a line of code. Let's s...
Hi, say I have an asynchronous library, written in native C++, with an interface similar to this: class connection { public: boost::signal< void() > sig_connection_made; boost::signal< void(const std::string&) > sig_error; void connect(const std::string& host, const std::string& port); }; that I want to wrap in C#. Does ...
I'm going to use gSOAP to interact with a WCF webservice in my Mac project. It does pretty much exactly what I need and it does it well (pretty much the exact opposite of WSMakeStubs;)). The only downside is that it's C/C++ only, meaning I either need to convert all my types into C types on the fly or write a complete wrappering solution...
Hi, How do I accomplish text wrapping of table fields in SSRS Report, and proper landscaping when rendering the report to PDF format Thanks in advance Anna ...
I have run into a bit of a desgin issue with some code that I have been working on: My code basic looks like this: Main COM wrapper: public class MapinfoWrapper { public MapinfoWrapper() { Publics.InternalMapinfo = new MapinfoWrapper(); } public void Do(string cmd) { //Call COM do command } ...
I am in the process of writing a text editor. After looking at other text editors I have noticed that a number of them refer to a "soft" versus "hard" wrap. What is the difference? I can't seem to find the answer by searching. ...
In silverlight 2.0. I have some content that i want to scroll vertically and wrap horizontally. In the controls I have a dock panel. The DockPanel's last child, which fills it, is a ScrollViewer <UserControl x:Class="MyProject.MyControl" xmlns="http://schemas.microsoft.com/winfx/2006/xaml/presentation" xmlns:x="http://schemas.m...
I am having a problem with links wrapping. How do I prevent this? ![Wordwrap][1] [1]: ...
Hello, I would like to know if there was a way to set a width for lines outputted to aid in formatting, to make sure that lines always wrap after a certain amount. I will be using the code below to sort and print emails, and would prefer messages that are on very long lines are neatly broken up, but I am unsure how to do this. I have at...
Let's say that I have written a custom e-mail management application for the company that I work for. It reads e-mails from the company's support account and stores cleaned-up, plain text versions of them in a database, doing other neat things like associating it with customer accounts and orders in the process. When an employee replies ...
How can I make my text wrap automatically to the next line when I am writing text in a textbox rather than keeps on typing in one line? ...
In Visual Studio 2008, is there a way to keep the indentation of automatically wrapped long lines? (Only need it for C#.) When word wrap is turned on, it looks like this: var a = SomeFunctionOrWhateverWithSuperLongName(parameter1, parameter2); I want it to look like this: var a = SomeFunctionOrWhateverWithSuperLong...
Hello, Does anybody knows a good wrapper implementation for Google Search Appliance? ...
Hi all, So I have a DIV that contains some dynamic text. Let's say I know the text and font-size but I don't know the size of the DIV. I'd like the display of the text in the DIV to be intelligent enough to show indentation when text wraps. Say my original text looked something like this: Lorem ipsum dolor sit amet, consectetur ad...
I'm using iText to generate PDF reports - came across this issue, and worked up a simple example to illustrate it. I'm combining simple paragraphs, and images. The height of the images is such that 3 will fit on a PDF page, but when if text is on a page, only 2 images will fit. I create my iText PDF like so Document document = new ...
I have a long string (a DNA sequence). It does not contain any whitespace character. e.g.: ACTGATCGAGCTGAAGCGCAGTGCGATGCTTCGATGATGCTGACGATGCTACGATGCGAGCATCTACGATCAGTCGATGTAGCTAGTAGCATGTAGTGA what would be the css selector to force this text to be wrapped in an html:textarea or in a xul:textbox Thanks. ...
I'm implementing James Bennett's excellent django-contact-form but have hit a snag. My contact page not only contains the form, but also additional flat page information. Without rewriting the existing view the contact form uses, I'd like to be able to wrap, or chain, the views. This way I could inject some additional information vi...